|
|
|
View Template Information
EURExpress Template ID: T874
| Clone ID |
E874 |
| Template ID |
T874 |
| Template Generating Unit |
B |
| Plate |
10 |
| Well |
C09 |
| Clone image |
1923754 |
| Gene symbol |
Apoa1 |
| Gene description |
apolipoprotein A-I (Apoa1) |
| Aliases |
MGC, Sep2, Alp-1, Ltw-1, Sep-1, Sep-2, Apoa-1, Brp-14, Lvtw-1 |
| Entrez gene ID |
11806 |
| Entrez ID version |
|
| mRNA reference sequence |
NM_009692 |
| Entrez accession ID version |
|
| ENSEMB transcript ID |
ENSMUST00000034588 |
| Transcript version |
29 |
| ENSEMB gene ID |
ENSMUSG00000032083 |
| Gene version |
29 |
| Template status |
OK |
| Working reference |
|
| Sequence Status |
|
| Plasmid name |
pME18S-FL3 |
| Promoter to generate antisense probe |
T3 |
| Antisense promoter primer sequence |
AATTAACCCTCACTAAAGGGAGA |
| Forward and reverse primers position |
|
| Forward and reverse primer sequences |
|
|
| |
 Sequence
|
|
|
|
