|
|
|
View Template Information
EURExpress Template ID: T7709
| Clone ID |
E7709 |
| Template ID |
T7709 |
| Template Generating Unit |
B |
| Plate |
83 |
| Well |
G09 |
| Clone image |
6308147 |
| Gene symbol |
Tpp2 |
| Gene description |
tripeptidyl peptidase II |
| Aliases |
TppII |
| Entrez gene ID |
22019 |
| Entrez ID version |
|
| mRNA reference sequence |
NM_009418 |
| Entrez accession ID version |
|
| ENSEMB transcript ID |
|
| Transcript version |
29 |
| ENSEMB gene ID |
|
| Gene version |
29 |
| Template status |
OK |
| Working reference |
|
| Sequence Status |
|
| Plasmid name |
pCMV-SPORT6.1 |
| Promoter to generate antisense probe |
T7 |
| Antisense promoter primer sequence |
TAATACGACTCACTATAGGGAGA |
| Forward and reverse primers position |
|
| Forward and reverse primer sequences |
|
|
| |
 Sequence
|
|
|
|
