|
|
|
View Template Information
EURExpress Template ID: T4720
| Clone ID |
E4720 |
| Template ID |
T4720 |
| Template Generating Unit |
M |
| Plate |
52 |
| Well |
G07 |
| Clone image |
5036675 |
| Gene symbol |
Olfm1 |
| Gene description |
olfactomedin 1 (Olfm1) |
| Aliases |
AMY, Noe1, OlfA, Pancortin, Pancortin3 |
| Entrez gene ID |
56177 |
| Entrez ID version |
|
| mRNA reference sequence |
NM_019498 |
| Entrez accession ID version |
|
| ENSEMB transcript ID |
|
| Transcript version |
29 |
| ENSEMB gene ID |
|
| Gene version |
29 |
| Template status |
OK |
| Working reference |
|
| Sequence Status |
|
| Plasmid name |
pCMV-SPORT6 |
| Promoter to generate antisense probe |
T7 |
| Antisense promoter primer sequence |
TAATACGACTCACTATAGGGAGA |
| Forward and reverse primers position |
|
| Forward and reverse primer sequences |
|
|
| |
 Sequence
|
|
|
|
