|
|
|
View Template Information
EURExpress Template ID: T400
| Clone ID |
E400 |
| Template ID |
T400 |
| Template Generating Unit |
M |
| Plate |
5 |
| Well |
C07 |
| Clone image |
3156989 |
| Gene symbol |
Ddx18 |
| Gene description |
DEAD (Asp-Glu-Ala-Asp) box polypeptide 18 (Ddx18) |
| Aliases |
2310005B10Rik |
| Entrez gene ID |
66942 |
| Entrez ID version |
|
| mRNA reference sequence |
NM_025860 |
| Entrez accession ID version |
|
| ENSEMB transcript ID |
ENSMUST00000001724 |
| Transcript version |
29 |
| ENSEMB gene ID |
ENSMUSG00000001674 |
| Gene version |
29 |
| Template status |
OK |
| Working reference |
|
| Sequence Status |
|
| Plasmid name |
pCMV-SPORT6 |
| Promoter to generate antisense probe |
T7 |
| Antisense promoter primer sequence |
TAATACGACTCACTATAGGGAGA |
| Forward and reverse primers position |
|
| Forward and reverse primer sequences |
|
|
| |
 Sequence
|
|
|
|
