|
|
|
View Template Information
EURExpress Template ID: T3875
| Clone ID |
E3875 |
| Template ID |
T3875 |
| Template Generating Unit |
B |
| Plate |
43 |
| Well |
A06 |
| Clone image |
550702 |
| Gene symbol |
Birc4 |
| Gene description |
baculoviral IAP repeat-containing 4 |
| Aliases |
Aipa, Api3, IAP3, ILP-1, MIHA, XIAP, mXIAP |
| Entrez gene ID |
11798 |
| Entrez ID version |
|
| mRNA reference sequence |
NM_009688 |
| Entrez accession ID version |
|
| ENSEMB transcript ID |
|
| Transcript version |
29 |
| ENSEMB gene ID |
ENSMUSG00000025860 |
| Gene version |
29 |
| Template status |
OK |
| Working reference |
|
| Sequence Status |
|
| Plasmid name |
pBluescript SK- |
| Promoter to generate antisense probe |
T7 |
| Antisense promoter primer sequence |
TAATACGACTCACTATAGGGAGA |
| Forward and reverse primers position |
|
| Forward and reverse primer sequences |
|
|
| |
 Sequence
|
|
|
|
