Eurexpress

Eurexpress Template

Eurexpress Template ID: T36036
Clone ID E36036
Template ID T36036
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol BC050789
Gene description cDNA sequence BC050789
Gene Aliases 4931432L23
MGI ID MGI:2674085
Entrez Gene ID 213234
Ref Seq Accession NM_172515
Chromosome Location 3
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 067227_F_cDNA_BC050789
Forward Primer Sequences AACTCCACAGGAACAACTTCGT
Reverse Primer 067227_N_SP6_cDNA_BC050789
Reverse Primer Sequences GCGATTTAGGTGACACTATAGTCCCAAGTGACATGCAGGAAT
Template Plate 10017_TEM
Template Well 10017_TEM_B03
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence

Eurexpress

Eurexpress Template

Eurexpress Template ID: T36036
Clone ID E36036
Template ID T36036
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol BC050789
Gene description cDNA sequence BC050789
Gene Aliases 4931432L23
MGI ID MGI:2674085
Entrez Gene ID 213234
Ref Seq Accession NM_172515
Chromosome Location 3
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 067227_F_cDNA_BC050789
Forward Primer Sequences AACTCCACAGGAACAACTTCGT
Reverse Primer 067227_N_SP6_cDNA_BC050789
Reverse Primer Sequences GCGATTTAGGTGACACTATAGTCCCAAGTGACATGCAGGAAT
Template Plate 10017_TEM
Template Well 10017_TEM_B03
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence