Eurexpress

Eurexpress Template

Eurexpress Template ID: T3719
Clone ID E3719
Template ID T3719
Template Origin Plasmid
Clone Image 3327020
Validity OK
Gene symbol 3110009E18Rik
Gene description RIKEN cDNA 3110009E18 gene
Gene Aliases  
MGI ID MGI:1920353
Entrez Gene ID 73103
Ref Seq Accession NM_028439
Chromosome Location 1
ENSEMBL Transcript ID ENSMUST00000056038
ENSEMBL Gene ID ENSMUSG00000026388
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 40
Template Well H03
Template Group  
Template Sequence Status Partial
Template Sequence ID 3327020_r1BE331909BX
TGU B
 Template Sequence

Eurexpress

Eurexpress Template

Eurexpress Template ID: T3719
Clone ID E3719
Template ID T3719
Template Origin Plasmid
Clone Image 3327020
Validity OK
Gene symbol 3110009E18Rik
Gene description RIKEN cDNA 3110009E18 gene
Gene Aliases  
MGI ID MGI:1920353
Entrez Gene ID 73103
Ref Seq Accession NM_028439
Chromosome Location 1
ENSEMBL Transcript ID ENSMUST00000056038
ENSEMBL Gene ID ENSMUSG00000026388
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 40
Template Well H03
Template Group  
Template Sequence Status Partial
Template Sequence ID 3327020_r1BE331909BX
TGU B
 Template Sequence