Eurexpress

Eurexpress Template

Eurexpress Template ID: T35901
Clone ID E35901
Template ID T35901
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol AI464131
Gene description expressed sequence AI464131
Gene Aliases AA408153, AI604836, Gm762
MGI ID MGI:2140300
Entrez Gene ID 329828
Ref Seq Accession XM_283952
Chromosome Location 4
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 077827_F_cDNA_AI464131
Forward Primer Sequences CAAACCCAGTTTAAGAGTTCCG
Reverse Primer 077827_N_SP6_cDNA_AI464131
Reverse Primer Sequences GCGATTTAGGTGACACTATAGCCAGCTGACTGACAAACGAAG
Template Plate 10014_TEM
Template Well 10014_TEM_G03
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence

Eurexpress

Eurexpress Template

Eurexpress Template ID: T35901
Clone ID E35901
Template ID T35901
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol AI464131
Gene description expressed sequence AI464131
Gene Aliases AA408153, AI604836, Gm762
MGI ID MGI:2140300
Entrez Gene ID 329828
Ref Seq Accession XM_283952
Chromosome Location 4
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 077827_F_cDNA_AI464131
Forward Primer Sequences CAAACCCAGTTTAAGAGTTCCG
Reverse Primer 077827_N_SP6_cDNA_AI464131
Reverse Primer Sequences GCGATTTAGGTGACACTATAGCCAGCTGACTGACAAACGAAG
Template Plate 10014_TEM
Template Well 10014_TEM_G03
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence