| Eurexpress Template ID: T2702 |
| Clone ID |
E2702 |
| Template ID |
T2702 |
| Template Origin |
Plasmid |
| Clone Image |
1512304 |
| Validity |
OK |
| Gene symbol |
Tle1 |
| Gene description |
transducin-like enhancer of split 1, homolog of Drosophila E(spl) (Tle1) |
| Gene Aliases |
Grg1, C230057C06Rik |
| MGI ID |
MGI:104636 |
| Entrez Gene ID |
21885 |
| Ref Seq Accession |
NM_011599 |
| Chromosome Location |
4 |
| ENSEMBL Transcript ID |
ENSMUST00000030095 |
| ENSEMBL Gene ID |
ENSMUSG00000008305 |
| ENSEMBL version |
|
| Vector (Plasmid) |
pT7T3D-PacI |
| AntiSense Promoter |
T3 |
| Sense Promoter |
T7 |
| Forward Primer |
RZPD M13 forward |
| Forward Primer Sequences |
GCTATTACGCCAGCTGGCGAAAGGGGGATGTG |
| Reverse Primer |
RZPD M13 reverse |
| Reverse Primer Sequences |
CCCCAGGCTTTACACTTTATGCTTCCGGCTCG |
| Template Plate |
30 |
| Template Well |
C06 |
| Template Group |
|
| Template Sequence Status |
Partial |
| Template Sequence ID |
1512304_r1AW989244BX |
| TGU |
M |
|
|
Template Sequence