Eurexpress

Eurexpress Template

Eurexpress Template ID: T7635
Clone ID E7635
Template ID T7635
Template Origin Plasmid
Clone Image 30112559
Validity OK
Gene symbol LOC245128
Gene description similar to solute carrier family 7 (cationic amino acid transporter, y+ system), member 3
Gene Aliases MGC91100, MGC91107
MGI ID MGI:2142124
Entrez Gene ID 245128
Ref Seq Accession NM_001004153
Chromosome Location 7
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 83
Template Well A06
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC080735
TGU B
 Template Sequence

Eurexpress

Eurexpress Template

Eurexpress Template ID: T7635
Clone ID E7635
Template ID T7635
Template Origin Plasmid
Clone Image 30112559
Validity OK
Gene symbol LOC245128
Gene description similar to solute carrier family 7 (cationic amino acid transporter, y+ system), member 3
Gene Aliases MGC91100, MGC91107
MGI ID MGI:2142124
Entrez Gene ID 245128
Ref Seq Accession NM_001004153
Chromosome Location 7
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 83
Template Well A06
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC080735
TGU B
 Template Sequence