Eurexpress

Eurexpress Template

Eurexpress Template ID: T35585
Clone ID E35585
Template ID T35585
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Zfp92
Gene description zinc finger protein 92
Gene Aliases  
MGI ID MGI:108094
Entrez Gene ID 22754
Ref Seq Accession NM_009566
Chromosome Location X
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 074232_F_cDNA_Zfp92
Forward Primer Sequences AGAAGCCTGTTATTTCGAGCAC
Reverse Primer 074232_N_SP6_cDNA_Zfp92
Reverse Primer Sequences GCGATTTAGGTGACACTATAGGAAACCACCCCACATTAAACA
Template Plate 10009_TEM
Template Well 10009_TEM_A11
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence

Eurexpress

Eurexpress Template

Eurexpress Template ID: T35585
Clone ID E35585
Template ID T35585
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Zfp92
Gene description zinc finger protein 92
Gene Aliases  
MGI ID MGI:108094
Entrez Gene ID 22754
Ref Seq Accession NM_009566
Chromosome Location X
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 074232_F_cDNA_Zfp92
Forward Primer Sequences AGAAGCCTGTTATTTCGAGCAC
Reverse Primer 074232_N_SP6_cDNA_Zfp92
Reverse Primer Sequences GCGATTTAGGTGACACTATAGGAAACCACCCCACATTAAACA
Template Plate 10009_TEM
Template Well 10009_TEM_A11
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence