Eurexpress

Eurexpress Template

Eurexpress Template ID: T8167
Clone ID E8167
Template ID T8167
Template Origin Plasmid
Clone Image 5056396
Validity OK
Gene symbol Galnt9
Gene description UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9
Gene Aliases 6430598F23, GalNAc-T9
MGI ID MGI:2677965
Entrez Gene ID 231605
Ref Seq Accession NM_198306
Chromosome Location 5
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 89
Template Well A01
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC054061
TGU M
 Template Sequence

Eurexpress

Eurexpress Template

Eurexpress Template ID: T8167
Clone ID E8167
Template ID T8167
Template Origin Plasmid
Clone Image 5056396
Validity OK
Gene symbol Galnt9
Gene description UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9
Gene Aliases 6430598F23, GalNAc-T9
MGI ID MGI:2677965
Entrez Gene ID 231605
Ref Seq Accession NM_198306
Chromosome Location 5
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 89
Template Well A01
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC054061
TGU M
 Template Sequence