Eurexpress

Eurexpress Template

Eurexpress Template ID: T9831
Clone ID E9831
Template ID T9831
Template Origin Plasmid
Clone Image 6772873
Validity OK
Gene symbol Dnajb8
Gene description Mus musculus DnaJ (Hsp40) homolog, subfamily B, member 8 (Dnajb8), mRNA.
Gene Aliases mDj6, 1700016F14Rik, 1700031F10Rik
MGI ID MGI:1922801
Entrez Gene ID 56691
Ref Seq Accession NM_019964
Chromosome Location 6
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pDNR-LIB
AntiSense Promoter T3
Sense Promoter T7
Forward Primer M13 forward (-21)
Forward Primer Sequences TGTAAAACGACGGCCAGT
Reverse Primer T3-pDNR-LIB rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGTGTTCACTTACCTACTGGGC
Template Plate 1004
Template Well B12
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC061112
TGU M
 Template Sequence

Eurexpress

Eurexpress Template

Eurexpress Template ID: T9831
Clone ID E9831
Template ID T9831
Template Origin Plasmid
Clone Image 6772873
Validity OK
Gene symbol Dnajb8
Gene description Mus musculus DnaJ (Hsp40) homolog, subfamily B, member 8 (Dnajb8), mRNA.
Gene Aliases mDj6, 1700016F14Rik, 1700031F10Rik
MGI ID MGI:1922801
Entrez Gene ID 56691
Ref Seq Accession NM_019964
Chromosome Location 6
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pDNR-LIB
AntiSense Promoter T3
Sense Promoter T7
Forward Primer M13 forward (-21)
Forward Primer Sequences TGTAAAACGACGGCCAGT
Reverse Primer T3-pDNR-LIB rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGTGTTCACTTACCTACTGGGC
Template Plate 1004
Template Well B12
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC061112
TGU M
 Template Sequence