Eurexpress

Eurexpress Template

Eurexpress Template ID: T36843
Clone ID E36843
Template ID T36843
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Polr2a
Gene description polymerase (RNA) II (DNA directed) polypeptide A
Gene Aliases 220kDa, Rpo2-1
MGI ID MGI:98086
Entrez Gene ID 20020
Ref Seq Accession NM_009089
Chromosome Location 11
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 098514_F_cDNA_Polr2a
Forward Primer Sequences CAGGAATGGATCTTAGAGACGG
Reverse Primer 098514_N_SP6_cDNA_Polr2a
Reverse Primer Sequences GCGATTTAGGTGACACTATAGGAGGGGCTCTGGGGTGTATAG
Template Plate 10031_TEM
Template Well 10031_TEM_E03
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence

Eurexpress

Eurexpress Template

Eurexpress Template ID: T36843
Clone ID E36843
Template ID T36843
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Polr2a
Gene description polymerase (RNA) II (DNA directed) polypeptide A
Gene Aliases 220kDa, Rpo2-1
MGI ID MGI:98086
Entrez Gene ID 20020
Ref Seq Accession NM_009089
Chromosome Location 11
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 098514_F_cDNA_Polr2a
Forward Primer Sequences CAGGAATGGATCTTAGAGACGG
Reverse Primer 098514_N_SP6_cDNA_Polr2a
Reverse Primer Sequences GCGATTTAGGTGACACTATAGGAGGGGCTCTGGGGTGTATAG
Template Plate 10031_TEM
Template Well 10031_TEM_E03
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence