Eurexpress

Eurexpress Template

Eurexpress Template ID: T36858
Clone ID E36858
Template ID T36858
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Sox30
Gene description SRY-box containing gene 30
Gene Aliases  
MGI ID MGI:1341157
Entrez Gene ID 214105
Ref Seq Accession NM_173384
Chromosome Location 11
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 067882_F_cDNA_Sox30
Forward Primer Sequences TTCAGAACACCATCACTCATCC
Reverse Primer 067882_N_SP6_cDNA_Sox30
Reverse Primer Sequences GCGATTTAGGTGACACTATAGGGCCATGGCTGCTGTAGTAAG
Template Plate 10031_TEM
Template Well 10031_TEM_H04
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence

Eurexpress

Eurexpress Template

Eurexpress Template ID: T36858
Clone ID E36858
Template ID T36858
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Sox30
Gene description SRY-box containing gene 30
Gene Aliases  
MGI ID MGI:1341157
Entrez Gene ID 214105
Ref Seq Accession NM_173384
Chromosome Location 11
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 067882_F_cDNA_Sox30
Forward Primer Sequences TTCAGAACACCATCACTCATCC
Reverse Primer 067882_N_SP6_cDNA_Sox30
Reverse Primer Sequences GCGATTTAGGTGACACTATAGGGCCATGGCTGCTGTAGTAAG
Template Plate 10031_TEM
Template Well 10031_TEM_H04
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence