Eurexpress

Eurexpress Template

Eurexpress Template ID: T37002
Clone ID E37002
Template ID T37002
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Sema4b
Gene description sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B
Gene Aliases KIAA1745, SemC, Semac, mKIAA1745
MGI ID MGI:107559
Entrez Gene ID 20352
Ref Seq Accession NM_013659
Chromosome Location 7
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 064315_F_cDNA_Sema4b
Forward Primer Sequences GCAAGAATTCCTCATACAAGGC
Reverse Primer 064315_N_SP6_cDNA_Sema4b
Reverse Primer Sequences GCGATTTAGGTGACACTATAGAGCTATCCGACAGAGCCTGGT
Template Plate 10034_TEM
Template Well 10034_TEM_E03
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence