Eurexpress

Eurexpress Template

Eurexpress Template ID: T35362
Clone ID E35362
Template ID T35362
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol 1700007K09Rik
Gene description RIKEN cDNA 1700007K09 gene
Gene Aliases  
MGI ID MGI:1916568
Entrez Gene ID 69318
Ref Seq Accession NM_027037
Chromosome Location 7
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 080993_F_cDNA_1700007K09Rik
Forward Primer Sequences CAGAAAGCCTCCTGACATCTCT
Reverse Primer 080993_N_SP6_cDNA_1700007K09Rik
Reverse Primer Sequences GCGATTTAGGTGACACTATAGGTGTTGGCCTGGTAGGAATGA
Template Plate 10005_TEM
Template Well 10005_TEM_D07
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence