Eurexpress

Eurexpress Template

Eurexpress Template ID: T866
Clone ID E866
Template ID T866
Template Origin Plasmid
Clone Image 1923521
Validity OK
Gene symbol 1810054G18Rik
Gene description RIKEN cDNA 1810054G18 gene (1810054G18Rik)
Gene Aliases  
MGI ID MGI:1922910
Entrez Gene ID 75660
Ref Seq Accession NM_029377
Chromosome Location 7
ENSEMBL Transcript ID NA
ENSEMBL Gene ID NA
ENSEMBL version  
Vector (Plasmid) pME18S-FL3
AntiSense Promoter T3
Sense Promoter T7
Forward Primer T7-pME18S-FL3-fw
Forward Primer Sequences CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG
Reverse Primer T3-pME18S-FL3-rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC
Template Plate 10
Template Well C01
Template Group  
Template Sequence Status Partial
Template Sequence ID 1923521_r1AI314394BX
TGU B
 Template Sequence