Eurexpress

Eurexpress Template

Eurexpress Template ID: T6887
Clone ID E6887
Template ID T6887
Template Origin Plasmid
Clone Image 3967527
Validity OK
Gene symbol Zfp61
Gene description zinc finger protein 61 (Zfp61).
Gene Aliases  
MGI ID MGI:99663
Entrez Gene ID 22719
Ref Seq Accession NM_009561
Chromosome Location 7
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 74
Template Well B10
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC006618
TGU M
 Template Sequence

Eurexpress

Eurexpress Template

Eurexpress Template ID: T6887
Clone ID E6887
Template ID T6887
Template Origin Plasmid
Clone Image 3967527
Validity OK
Gene symbol Zfp61
Gene description zinc finger protein 61 (Zfp61).
Gene Aliases  
MGI ID MGI:99663
Entrez Gene ID 22719
Ref Seq Accession NM_009561
Chromosome Location 7
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 74
Template Well B10
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC006618
TGU M
 Template Sequence