Eurexpress

Eurexpress Template

Eurexpress Template ID: T3203
Clone ID E3203
Template ID T3203
Template Origin Plasmid
Clone Image 1550194
Validity OK
Gene symbol Fbxl11
Gene description F-box and leucine-rich repeat protein 11 (Fbxl11)
Gene Aliases Fbl7, Cxxc8, Fbl11, lalina
MGI ID MGI:1354736
Entrez Gene ID 225876
Ref Seq Accession NM_001001984
Chromosome Location 19
ENSEMBL Transcript ID ENSMUST00000047898
ENSEMBL Gene ID ENSMUSG00000054611
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 35
Template Well E03
Template Group  
Template Sequence Status Partial
Template Sequence ID 1550194_r1BX523368BE
TGU B
 Template Sequence