Eurexpress

Eurexpress Template

Eurexpress Template ID: T2439
Clone ID E2439
Template ID T2439
Template Origin Plasmid
Clone Image 1245862
Validity OK
Gene symbol E130303B06Rik
Gene description RIKEN cDNA E130303B06 gene (E130303B06Rik)
Gene Aliases  
MGI ID MGI:2142593
Entrez Gene ID 102124
Ref Seq Accession NM_198299
Chromosome Location 8
ENSEMBL Transcript ID ENSMUST00000013299
ENSEMBL Gene ID ENSMUSG00000013155
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 27
Template Well E07
Template Group  
Template Sequence Status Partial
Template Sequence ID BC0524981245862_r1AA
TGU M
 Template Sequence

Eurexpress

Eurexpress Template

Eurexpress Template ID: T2439
Clone ID E2439
Template ID T2439
Template Origin Plasmid
Clone Image 1245862
Validity OK
Gene symbol E130303B06Rik
Gene description RIKEN cDNA E130303B06 gene (E130303B06Rik)
Gene Aliases  
MGI ID MGI:2142593
Entrez Gene ID 102124
Ref Seq Accession NM_198299
Chromosome Location 8
ENSEMBL Transcript ID ENSMUST00000013299
ENSEMBL Gene ID ENSMUSG00000013155
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 27
Template Well E07
Template Group  
Template Sequence Status Partial
Template Sequence ID BC0524981245862_r1AA
TGU M
 Template Sequence