Eurexpress

Eurexpress Template

Eurexpress Template ID: T6273
Clone ID E6273
Template ID T6273
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol E330016A19Rik
Gene description RIKEN cDNA E330016A19 gene (E330016A19Rik)
Gene Aliases  
MGI ID MGI:2442261
Entrez Gene ID 214763
Ref Seq Accession NM_173386
Chromosome Location 9
ENSEMBL Transcript ID ENSMUST00000085306
ENSEMBL Gene ID ENSMUSG00000032344
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer  
Forward Primer Sequences CCCGCCATATATTTAAGTTTC
Reverse Primer  
Reverse Primer Sequences gcgATTTAGGTGACACTATAG-ATAGTAGCTGCCAGTGTTCAG
Template Plate  
Template Well  
Template Group ENCODE
Template Sequence Status Partial
Template Sequence ID  
TGU M
 Template Sequence

Eurexpress

Eurexpress Template

Eurexpress Template ID: T6273
Clone ID E6273
Template ID T6273
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol E330016A19Rik
Gene description RIKEN cDNA E330016A19 gene (E330016A19Rik)
Gene Aliases  
MGI ID MGI:2442261
Entrez Gene ID 214763
Ref Seq Accession NM_173386
Chromosome Location 9
ENSEMBL Transcript ID ENSMUST00000085306
ENSEMBL Gene ID ENSMUSG00000032344
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer  
Forward Primer Sequences CCCGCCATATATTTAAGTTTC
Reverse Primer  
Reverse Primer Sequences gcgATTTAGGTGACACTATAG-ATAGTAGCTGCCAGTGTTCAG
Template Plate  
Template Well  
Template Group ENCODE
Template Sequence Status Partial
Template Sequence ID  
TGU M
 Template Sequence