Eurexpress

Eurexpress Template

Eurexpress Template ID: T4337
Clone ID E4337
Template ID T4337
Template Origin Plasmid
Clone Image 4526980
Validity OK
Gene symbol Ankrd24
Gene description ankyrin repeat domain 24 (Ankrd24)
Gene Aliases D10Bur2e, 4631433D01Rik, 5730519E19Rik
MGI ID MGI:1890394
Entrez Gene ID 70615
Ref Seq Accession NM_027480
Chromosome Location 10
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 48
Template Well G01
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC017633
TGU M
 Template Sequence

Eurexpress

Eurexpress Template

Eurexpress Template ID: T4337
Clone ID E4337
Template ID T4337
Template Origin Plasmid
Clone Image 4526980
Validity OK
Gene symbol Ankrd24
Gene description ankyrin repeat domain 24 (Ankrd24)
Gene Aliases D10Bur2e, 4631433D01Rik, 5730519E19Rik
MGI ID MGI:1890394
Entrez Gene ID 70615
Ref Seq Accession NM_027480
Chromosome Location 10
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 48
Template Well G01
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC017633
TGU M
 Template Sequence