Eurexpress

Eurexpress Template

Eurexpress Template ID: T35808
Clone ID E35808
Template ID T35808
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol A230069A22Rik
Gene description RIKEN cDNA A230069A22 gene
Gene Aliases  
MGI ID MGI:2444329
Entrez Gene ID 320587
Ref Seq Accession NM_001033394
Chromosome Location 4
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 078463_F_cDNA_A230069A22Rik
Forward Primer Sequences ATTCCTGTGTCACTCAAGGGTT
Reverse Primer 078463_N_SP6_cDNA_A230069A22Rik
Reverse Primer Sequences GCGATTTAGGTGACACTATAGGAATGCAAGCTGAGTGCTAGG
Template Plate 10013_TEM
Template Well 10013_TEM_A11
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence

Eurexpress

Eurexpress Template

Eurexpress Template ID: T35808
Clone ID E35808
Template ID T35808
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol A230069A22Rik
Gene description RIKEN cDNA A230069A22 gene
Gene Aliases  
MGI ID MGI:2444329
Entrez Gene ID 320587
Ref Seq Accession NM_001033394
Chromosome Location 4
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 078463_F_cDNA_A230069A22Rik
Forward Primer Sequences ATTCCTGTGTCACTCAAGGGTT
Reverse Primer 078463_N_SP6_cDNA_A230069A22Rik
Reverse Primer Sequences GCGATTTAGGTGACACTATAGGAATGCAAGCTGAGTGCTAGG
Template Plate 10013_TEM
Template Well 10013_TEM_A11
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence