Eurexpress

Eurexpress Template

Eurexpress Template ID: T641
Clone ID E641
Template ID T641
Template Origin Plasmid
Clone Image 1887134
Validity OK
Gene symbol Cyp2b10
Gene description cytochrome P450, family 2, subfamily b, polypeptide 10 (Cyp2b10)
Gene Aliases p16, Cyp2b, Cyp2b20
MGI ID MGI:88598
Entrez Gene ID 13088
Ref Seq Accession NM_009999
Chromosome Location 7
ENSEMBL Transcript ID ENSMUST00000082214
ENSEMBL Gene ID ENSMUSG00000030483
ENSEMBL version  
Vector (Plasmid) pME18S-FL3
AntiSense Promoter T3
Sense Promoter T7
Forward Primer T7-pME18S-FL3-fw
Forward Primer Sequences CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG
Reverse Primer T3-pME18S-FL3-rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC
Template Plate 7
Template Well H04
Template Group  
Template Sequence Status Partial
Template Sequence ID 1887134_r1AI304065BX
TGU M
 Template Sequence