Eurexpress

Eurexpress Template

Eurexpress Template ID: T2125
Clone ID E2125
Template ID T2125
Template Origin Plasmid
Clone Image 864428
Validity OK
Gene symbol Asb11
Gene description ankyrin repeat and SOCS box-containing protein 11 (Asb11)
Gene Aliases 1110067L12Rik, 1600009D24Rik
MGI ID MGI:1916104
Entrez Gene ID 68854
Ref Seq Accession NM_026853
Chromosome Location X
ENSEMBL Transcript ID ENSMUST00000033755
ENSEMBL Gene ID ENSMUSG00000031382
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 24
Template Well C05
Template Group  
Template Sequence Status Partial
Template Sequence ID BC064047864428_r1AI6
TGU M
 Template Sequence