Eurexpress

Eurexpress Template

Eurexpress Template ID: T2055
Clone ID E2055
Template ID T2055
Template Origin Plasmid
Clone Image 807542
Validity OK
Gene symbol 1300014I06Rik
Gene description RIKEN cDNA 1300014I06 gene (1300014I06Rik)
Gene Aliases  
MGI ID MGI:1914145
Entrez Gene ID 66895
Ref Seq Accession NM_025831
Chromosome Location 13
ENSEMBL Transcript ID ENSMUST00000053459
ENSEMBL Gene ID ENSMUSG00000021411
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 23
Template Well E07
Template Group  
Template Sequence Status Partial
Template Sequence ID 807542_r1A413024AI46
TGU B
 Template Sequence