Eurexpress

Eurexpress Template

Eurexpress Template ID: T4938
Clone ID E4938
Template ID T4938
Template Origin Plasmid
Clone Image 5125733
Validity OK
Gene symbol 1110008F13Rik
Gene description RIKEN cDNA 1110008F13 gene (1110008F13Rik)
Gene Aliases AI316789
MGI ID MGI:1914638
Entrez Gene ID 67388
Ref Seq Accession NM_026124
Chromosome Location 2
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 55
Template Well B03
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC019445
TGU M
 Template Sequence