Eurexpress

Eurexpress Template

Eurexpress Template ID: T36481
Clone ID E36481
Template ID T36481
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Htra3
Gene description HtrA serine peptidase 3
Gene Aliases 2210021K23Rik, 9530081K03Rik, Prsp, Tasp
MGI ID MGI:1925808
Entrez Gene ID 78558
Ref Seq Accession NM_030127
Chromosome Location 5
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 091709_F_cDNA_Htra3
Forward Primer Sequences GCTTCCTCTCTGAGTTCCAAAA
Reverse Primer 091709_N_SP6_cDNA_Htra3
Reverse Primer Sequences GCGATTTAGGTGACACTATAGACTCATCTTCCTGTCCATCCTG
Template Plate 10025_TEM
Template Well 10025_TEM_E05
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence