Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T3535
Clone ID E3535
Template ID T3535
Template Origin Plasmid
Clone Image 3166596
Validity OK
Gene symbol Il4ra
Gene description interleukin 4 receptor, alpha (Il4ra), transcript variant 2
Gene Aliases Il4r, CD124
MGI ID MGI:105367
Entrez Gene ID 16190
Ref Seq Accession NM_010557
Chromosome Location 7
ENSEMBL Transcript ID ENSMUST00000072231
ENSEMBL Gene ID ENSMUSG00000030748
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 38
Template Well H11
Template Group  
Template Sequence Status Partial
Template Sequence ID 3166596_r1AW824961BX
TGU B
 Template Sequence