Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T3534
Clone ID E3534
Template ID T3534
Template Origin Plasmid
Clone Image 3166550
Validity OK
Gene symbol Mrps11
Gene description mitochondrial ribosomal protein S11 (Mrps11)
Gene Aliases 0710005I03Rik
MGI ID MGI:1915244
Entrez Gene ID 67994
Ref Seq Accession NM_026498
Chromosome Location 7
ENSEMBL Transcript ID ENSMUST00000032840
ENSEMBL Gene ID ENSMUSG00000030611
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 38
Template Well H10
Template Group  
Template Sequence Status Partial
Template Sequence ID 3166550_r1AW824921BX
TGU B
 Template Sequence