Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T35338
Clone ID E35338
Template ID T35338
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol 1110007C02Rik
Gene description RIKEN cDNA 1110007C02 gene
Gene Aliases AI480648
MGI ID MGI:88075
Entrez Gene ID 71784
Ref Seq Accession NM_027923
Chromosome Location 13
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 065525_F_cDNA_1110007C02Rik
Forward Primer Sequences GGCTTGGAGAATGAGGATACAC
Reverse Primer 065525_N_SP6_cDNA_1110007C02Rik
Reverse Primer Sequences GCGATTTAGGTGACACTATAGTATTAATGACCAGGAGATGCTGC
Template Plate 10004_TEM
Template Well 10004_TEM_H01
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence