Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T35337
Clone ID E35337
Template ID T35337
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol 1110004F10Rik
Gene description RIKEN cDNA 1110004F10 gene
Gene Aliases Smacp, Smap, sid2057, sid2057p
MGI ID MGI:1929274
Entrez Gene ID 56372
Ref Seq Accession NM_019772
Chromosome Location 7
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 100479_F_cDNA_1110004F10Rik
Forward Primer Sequences GATCTTGGATCTAGCAATTGGG
Reverse Primer 100479_N_SP6_cDNA_1110004F10Rik
Reverse Primer Sequences GCGATTTAGGTGACACTATAGAACTCCATGACGGACAGGTCT
Template Plate 10004_TEM
Template Well 10004_TEM_G11
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence