Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T3533
Clone ID E3533
Template ID T3533
Template Origin Plasmid
Clone Image 3166539
Validity OK
Gene symbol Coasy
Gene description Coenzyme A synthase (Coasy)
Gene Aliases Dpck, Ppat, Ukr1, 1300003G02Rik
MGI ID MGI:1918993
Entrez Gene ID 71743
Ref Seq Accession NM_027896
Chromosome Location 11
ENSEMBL Transcript ID ENSMUST00000001806
ENSEMBL Gene ID ENSMUSG00000001755
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 38
Template Well H09
Template Group  
Template Sequence Status Partial
Template Sequence ID 3166539_r1AW824926BX
TGU B
 Template Sequence