Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T35317
Clone ID E35317
Template ID T35317
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol V1rf1
Gene description vomeronasal 1 receptor, F1
Gene Aliases  
MGI ID MGI:2159635
Entrez Gene ID 171232
Ref Seq Accession NM_134198
Chromosome Location 17
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 102289_F_cDNA_V1rf1
Forward Primer Sequences AAGTGCATCAGCTCTTCCCTAT
Reverse Primer 102289_N_SP6_cDNA_V1rf1
Reverse Primer Sequences GCGATTTAGGTGACACTATAGGCTCCTAATCATATGTTCCATCC
Template Plate 10004_TEM
Template Well 10004_TEM_E06
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence