Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T35313
Clone ID E35313
Template ID T35313
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Uts2r
Gene description urotensin 2 receptor
Gene Aliases Gpr14, UTR, UTR2
MGI ID MGI:2183450
Entrez Gene ID 217369
Ref Seq Accession NM_145440
Chromosome Location 11
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 092684_F_cDNA_Uts2r
Forward Primer Sequences CTCTTTAGCCTGGACTTCCTGA
Reverse Primer 092684_N_SP6_cDNA_Uts2r
Reverse Primer Sequences GCGATTTAGGTGACACTATAGCCATTAGGGGGAACTGGAGAC
Template Plate 10004_TEM
Template Well 10004_TEM_E02
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence