Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T35297
Clone ID E35297
Template ID T35297
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Spna1
Gene description spectrin alpha 1
Gene Aliases AF093576, AI451697, Spna-1, ha, sph
MGI ID MGI:98385
Entrez Gene ID 20739
Ref Seq Accession NM_011465
Chromosome Location 1
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 092389_F_cDNA_Spna1
Forward Primer Sequences AAATGTCCCCTCCAGTCCTTAT
Reverse Primer 092389_N_SP6_cDNA_Spna1
Reverse Primer Sequences GCGATTTAGGTGACACTATAGCAGGAATTTCTCAAACTTGGGC
Template Plate 10004_TEM
Template Well 10004_TEM_C03
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence