Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T35293
Clone ID E35293
Template ID T35293
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Scn11a
Gene description sodium channel, voltage-gated, type XI, alpha
Gene Aliases NSS2, NaN, NaT, SNS2
MGI ID MGI:1345149
Entrez Gene ID 24046
Ref Seq Accession NM_011887
Chromosome Location 9
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 095094_F_cDNA_Scn11a
Forward Primer Sequences GGATGTTCTCTTTGCTTTCACC
Reverse Primer 095094_N_SP6_cDNA_Scn11a
Reverse Primer Sequences GCGATTTAGGTGACACTATAGAAAGGAGCTACATGTGGCAGG
Template Plate 10004_TEM
Template Well 10004_TEM_B08
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence