Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T3529
Clone ID E3529
Template ID T3529
Template Origin Plasmid
Clone Image 3166461
Validity OK
Gene symbol Als2cr2
Gene description amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 2 homolog (human) (Als2cr2), transcript variant A
Gene Aliases Papk, ILPIP, ILPIPA, D1Ucla2, PRO1038, B830008M19
MGI ID MGI:2144047
Entrez Gene ID 227154
Ref Seq Accession NM_172656
Chromosome Location 1
ENSEMBL Transcript ID ENSMUST00000027185
ENSEMBL Gene ID ENSMUSG00000026027
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 38
Template Well H05
Template Group  
Template Sequence Status Partial
Template Sequence ID 3166461_r1AW824855BX
TGU B
 Template Sequence