Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T3528
Clone ID E3528
Template ID T3528
Template Origin Plasmid
Clone Image 3166454
Validity OK
Gene symbol Anapc2
Gene description anaphase promoting complex subunit 2 (Anapc2)
Gene Aliases APC2, mKIAA1406, 9230107K09Rik
MGI ID MGI:2139135
Entrez Gene ID 99152
Ref Seq Accession NM_175300
Chromosome Location 2
ENSEMBL Transcript ID ENSMUST00000028341
ENSEMBL Gene ID ENSMUSG00000026965
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 38
Template Well H04
Template Group  
Template Sequence Status Partial
Template Sequence ID 3166454_r1AW824844BX
TGU B
 Template Sequence