Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T35181
Clone ID E35181
Template ID T35181
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Gpbar1
Gene description G protein-coupled bile acid receptor 1
Gene Aliases BG37, GPCR, GPR131, M-BAR, TGR5
MGI ID MGI:2653863
Entrez Gene ID 227289
Ref Seq Accession NM_174985
Chromosome Location 1
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 093484_F_cDNA_Gpbar1
Forward Primer Sequences ATGACACCCAACAGCACTGAG
Reverse Primer 093484_N_SP6_cDNA_Gpbar1
Reverse Primer Sequences GCGATTTAGGTGACACTATAGGACGCTCATAGGCCAAGACTG
Template Plate 10002_TEM
Template Well 10002_TEM_G07
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence