Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T35174
Clone ID E35174
Template ID T35174
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Gja6
Gene description gap junction membrane channel protein alpha 6
Gene Aliases A530015O12Rik, Cnx33, Gja-6
MGI ID MGI:95717
Entrez Gene ID 414089
Ref Seq Accession NM_001001496
Chromosome Location X
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 097059_F_cDNA_Gja6
Forward Primer Sequences TCCTCTTCATGTTTGTGGTGTC
Reverse Primer 097059_N_SP6_cDNA_Gja6
Reverse Primer Sequences GCGATTTAGGTGACACTATAGCACAATGCTTTCAAGCACAAG
Template Plate 10002_TEM
Template Well 10002_TEM_F11
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence