Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T35138
Clone ID E35138
Template ID T35138
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Chrm2
Gene description cholinergic receptor, muscarinic 2, cardiac
Gene Aliases Chrm-2, M2
MGI ID MGI:88397
Entrez Gene ID 243764
Ref Seq Accession NM_203491
Chromosome Location 6
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 096634_F_cDNA_Chrm2
Forward Primer Sequences TAGGGGTAAGGACTGTGGAAGA
Reverse Primer 096634_N_SP6_cDNA_Chrm2
Reverse Primer Sequences GCGATTTAGGTGACACTATAGCACGTGATGATGAAAGCCAAC
Template Plate 10002_TEM
Template Well 10002_TEM_C01
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence