Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T35134
Clone ID E35134
Template ID T35134
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Ccr9
Gene description chemokine (C-C motif) receptor 9
Gene Aliases Cmkbr10, GPR-9-6
MGI ID MGI:1341902
Entrez Gene ID 12769
Ref Seq Accession NM_009913
Chromosome Location 9
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 094349_F_cDNA_Ccr9
Forward Primer Sequences CAAGAAGTCATCCAAGCACAAG
Reverse Primer 094349_N_SP6_cDNA_Ccr9
Reverse Primer Sequences GCGATTTAGGTGACACTATAGTAACCAAAAACCAACTGCTGC
Template Plate 10002_TEM
Template Well 10002_TEM_B08
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence