Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T3513
Clone ID E3513
Template ID T3513
Template Origin Plasmid
Clone Image 337123
Validity OK
Gene symbol Slurp1
Gene description secreted Ly6/Plaur domain containing 1 (Slurp1)
Gene Aliases ARS, ArsB, Slurp-1, 1110021N19Rik
MGI ID MGI:1930923
Entrez Gene ID 57277
Ref Seq Accession NM_020519
Chromosome Location 15
ENSEMBL Transcript ID ENSMUST00000023261
ENSEMBL Gene ID ENSMUSG00000022596
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 38
Template Well G01
Template Group  
Template Sequence Status Partial
Template Sequence ID 337123_r1AI390978BX5
TGU B
 Template Sequence