Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T35118
Clone ID E35118
Template ID T35118
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Cacnb3
Gene description calcium channel, voltage-dependent, beta 3 subunit
Gene Aliases Beta3, Cchb3
MGI ID MGI:103307
Entrez Gene ID 12297
Ref Seq Accession NM_007581
Chromosome Location 15
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 097469_F_cDNA_Cacnb3
Forward Primer Sequences GAGGACTATGCAGATGCCTACC
Reverse Primer 097469_N_SP6_cDNA_Cacnb3
Reverse Primer Sequences GCGATTTAGGTGACACTATAGGTGAATGGAGTCCCTTTGCTT
Template Plate 10002_TEM
Template Well 10002_TEM_A02
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence