Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T35087
Clone ID E35087
Template ID T35087
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol 2810002O09Rik
Gene description RIKEN cDNA 2810002O09 gene
Gene Aliases  
MGI ID MGI:1919595
Entrez Gene ID 72345
Ref Seq Accession NM_175179
Chromosome Location X
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 068227_F_cDNA_2810002O09Rik
Forward Primer Sequences AAAGGAGCATCAACTTCTAGCG
Reverse Primer 068227_N_SP6_cDNA_2810002O09Rik
Reverse Primer Sequences GCGATTTAGGTGACACTATAGGTGTGGGGGCTCCTCTAGACT
Template Plate 10001_TEM
Template Well 10001_TEM_E08
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence