Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T35084
Clone ID E35084
Template ID T35084
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol 2700049A03Rik
Gene description RIKEN cDNA 2700049A03 gene
Gene Aliases mKIAA0586
MGI ID MGI:1924217
Entrez Gene ID 76967
Ref Seq Accession XM_916714
Chromosome Location 12
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 083731_F_cDNA_2700049A03Rik
Forward Primer Sequences TCCTGGTGATCTTTCAGGAACT
Reverse Primer 083731_N_SP6_cDNA_2700049A03Rik
Reverse Primer Sequences GCGATTTAGGTGACACTATAGTCCTGCAGAGTGCTGGATAAG
Template Plate 10001_TEM
Template Well 10001_TEM_E04
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence