Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T35083
Clone ID E35083
Template ID T35083
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol 2700046A07Rik
Gene description RIKEN cDNA 2700046A07 gene
Gene Aliases A330042I05Rik
MGI ID MGI:1919803
Entrez Gene ID 78449
Ref Seq Accession XM_001002365
Chromosome Location 18
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 085881_F_cDNA_2700046A07Rik
Forward Primer Sequences CTTGGAGCCTAAGGAAAGTGAA
Reverse Primer 085881_N_SP6_cDNA_2700046A07Rik
Reverse Primer Sequences GCGATTTAGGTGACACTATAGGTGCCCTATCTGGAGGCATTT
Template Plate 10001_TEM
Template Well 10001_TEM_E02
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence