Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T3506
Clone ID E3506
Template ID T3506
Template Origin Plasmid
Clone Image 336150
Validity OK
Gene symbol 1810008K03Rik
Gene description RIKEN cDNA 1810008K03 gene (1810008K03Rik)
Gene Aliases 1810008K03Rik
MGI ID MGI:1916315
Entrez Gene ID 69065
Ref Seq Accession NM_026929
Chromosome Location 2
ENSEMBL Transcript ID ENSMUST00000028780
ENSEMBL Gene ID ENSMUSG00000027313
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 38
Template Well F06
Template Group  
Template Sequence Status Partial
Template Sequence ID 336150_r1AI390168BX5
TGU B
 Template Sequence